AAGCAGGTTGTTAGGCACTGGTGTCTAAAATTTGGTCAAATTTTAGACACCATGAGCAATAGCACATTATCAACTGTGATCATTTAATTATCTCTTGTTCTCCCTAGCTACATTTTCTGCCTGTTGTCATAAAGATTAAG
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
0
1
0
1
0
0
0
0
0
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
1
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
0
1
0
1
0
0
0
0
1
1
0
1
0
0
0
0
1
1
0
1
0
0
0
1
1
1
0
1
0
0
0
0
1
1
0
1
0
1
0
1
0
0
0
1
0
0
0
1
1
1

Contract Research & Development for the Life Sciences

Contract Research & Development
for the Life Science Industries

- We help you solve your scientific problems -





- We can help you to solve your scientific problems -

70S Ribosome initiation complex (RCSB PDB-ID: 4V6G) with mRNA (yellow) and two tRNAs (green).

70S Ribosome initiation complex (RCSB PDB-ID: 4V6G)

© 2020 Holger Wallmeier